Journal: microPublication Biology

Article Title: An assessment of genome-editing efficiency of a newly developed Cas9 in C. elegans

doi: 10.17912/micropub.biology.000601

Figure Lengend Snippet:

Article Snippet: pDD162 , P eft-3::Cas9::tbb-2 3’UTR; P U6::empty sgRNA , Addgene #47549.

Techniques: Plasmid Preparation

Journal: bioRxiv

Article Title: Virus-free continuous directed evolution in human cells using somatic hypermutation

doi: 10.1101/2024.12.24.629435

Figure Lengend Snippet: ( A ) Transfection scheme for RA 1 cells using a two-plasmid system. ( B ) Integration scheme of homology cassette, following DSB formation by RNA guided Cas9. ( C ) Selection scheme for transfected RA 1 cells containing the puromycin resistance cassette, puroR. ( D ) FACS density plot of gated eGFP+ cells in untransfected RA 1 cells and those enriched through puromycin selection; FL1 represents the FITC fluorescence channel. ( E ) Imaging performed on enriched RA 1-274-eGFP cells following puromycin selection. Scale bar indicates 100 µM.

Article Snippet: The integration plasmid, p274, was sourced from Addgene (ID 164851), and the Cas9/sgRNA plasmid, p276, was also sourced from Addgene (ID 164850).

Techniques: Transfection, Plasmid Preparation, Selection, Fluorescence, Imaging

Journal: Nature protocols

Article Title: Large-scale reconstruction of cell lineages using single-cell readout of transcriptomes and CRISPRCas9 barcodes by scGESTALT

doi: 10.1038/s41596-018-0058-x

Figure Lengend Snippet: Left panels, During early and late developmental time periods, CRISPR-Cas9 induced indels record cell lineages as mutated genomic barcode sequences. Middle panels, Tissues of interest, such as brain, are dissociated into a single-cell suspension and loaded into a microfluidics device (inDrops). Single cells are encapsulated in droplets and indexed using hydrogels (color-coded to indicate different cell identifier primers) that are coated with oligodT primers. Polyadenylated cellular transcriptomes and scGESTALT lineage barcodes bind to the oligodT sequences and are simultaneously extracted from the same cells. Transcriptome libraries are sequenced to generate gene expression matrices for thousands of single cells. Gene expression profiles are used to perform dimensionality reduction using principal component analysis and visualized in two dimensions on a t-distributed stochastic neighbor embedding (t-SNE) plot. Single cells are represented as grey dots on the shown plot. A modularity-based clustering algorithm (Louvain) is used to cluster cells into discrete cell types using significant principal components. A t-SNE plot of 58,492 cells from n = 22 animals is color-coded to show 63 distinct clusters that were identified from zebrafish juvenile brains72. Right panels, scGESTALT libraries are sequenced to obtain lineage barcodes of profiled single cells. The inDrops index sequences are used to match transcriptomes and lineage barcodes for the same cells. Cell lineage trees are generated using maximum parsimony based on patterns of shared edits. Black and red nodes represent early and late barcode edits, respectively. Dashed lines connect profiled single cells to nodes on the tree. Cells connected to the same node are clonal (i.e. contain the same lineage barcode). Each cell is categorized into a discrete cell type (color coded rectangles) based on prior transcriptional clustering analysis. Brown shades represent forebrain cell types, blue shades represent midbrain cell types, green shades represent hindbrain cell types, and pink shades represent progenitor cell types. This procedure was approved by the HU/FAS Committee on the Use of Animals in Research & Teaching under Protocol No. 25–08. Figure adapted from ref72.

Article Snippet: Plasmids pCS2-zT2TP (available from Koichi Kawakami lab 78 ) pTol2-hspDRv7_scGstlt (Addgene, plasmid ID 108870) pTol2-hsp70l:Cas9-t2A-GFP, 5×U6:sgRNA (Addgene, plasmid ID 108871) DNA oligonucleotide sequences (purified by standard desalting, can be ordered from IDT) Name Sequence Purpose Step qPCRctrl F 5′-TCAGTCAACCATTCAGTGGCCCAT-3′ PCR amplify ultraconserved genomic region 23 qPCRctrl R 5′-CAGGAAAGGGAATGCAGGGTTTGT-3′ PCR amplify ultraconserved genomic region 23 qPCRdsRed F 5′-GAGCGCGTGATGAACTTCGAGG-3′ PCR amplify dsRed transgenic region 23 qPCRdsRed R 5′-CAGCCCATAGTCTTCTTCTGCATTACG-3′ PCR amplify dsRed transgenic region 23 sgRNAl 5′TTCTAATACGACTCACTATAGACAGCAGTATCATCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA1 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA2 5′-TTCTAATACGACTCACTATAGAGAGCGCGCTCGTCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA2 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA3 5′-TTCTAATACGACTCACTATAGTCAGCA GTACTACTGACGAGTTTTAGAGCTAGA-3′ Synthesize sgRNA3 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA4 5′-TTCTAATACGACTCACTATAGACAGCAGTGTGTGAGTCTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA4 for CRISPR-Cas9 lineage barcoding by injection 27 scGESTALT F 5′-TCGAGCTCAAGCTTCGG-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 scGESTALT R 5′-CTGCCATTTGTCTCGAGGTC-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 inDrops_GP6 5′-GAGGACTACACCATCGTGGAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_PE1Sa 5′-CTCTTTCCCTACACGACGCTGGGTGTCGGGTGCAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_GP12 5′-TCGTCGGCAGCGTCAGATGTGTATAA GAGACAG NNNNNNNNNTCGAGCTCAA GCTTCGGAC-3′, where N stands for a random base PCR amplify short scGESTALT fragment from inDrops library 93 inDrops_PE1Sb 5′-CTCTTTCCCTACACGACGCT-3′ PCR amplify short scGESTALT fragment from inDrops library 93 R1-PCRix 5′-AATGATACGGCGACCACCGAGATCTACACxrefTCGTCGGCAGCGTC-3′, where xref is an index sequence for multiplexing (see Supplementary Table 2 ) PCR amplify transcriptome or scGESTALT final sequencing library 97 R2-PCR 5′-CAAGCAGAAGACGGCATACGAGATGGGTGTCGGGTGCAG-3′ PCR amplify transcriptome or scGESTALT final sequencing library 97 Open in a separate window

Techniques: CRISPR, Expressing, Generated

Journal: Nature protocols

Article Title: Large-scale reconstruction of cell lineages using single-cell readout of transcriptomes and CRISPRCas9 barcodes by scGESTALT

doi: 10.1038/s41596-018-0058-x

Figure Lengend Snippet: An example of a reconstructed lineage tree from a single juvenile zebrafish brain. 376 edited barcodes were recovered from single cells using inDrops. A cell lineage tree was generated from the barcodes based on shared edits using a maximum parsimony approach. Black nodes represent early barcode edits (Cas9 and sgRNA injection at 1-cell stage, Step 35); red nodes represent late edits (heat shock-induced Cas9 transgene expression, Step 38). Dashed lines join single cells to terminal nodes (represent the final edited barcode sequence) on the tree. Distinct cell types (identified from simultaneous transcriptome capture and cell clustering analyses) are color coded as indicated in the legend. The edited barcode for each cell is shown as a white bar with deletions (red) and insertions (blue). Examples of clades and subclades are indicated on the tree. A clade on the tree represents all lineage barcodes that share at least one common edit, and sub-clades that branch from the original clade contain increasingly restricted subsets of barcodes that contain the previous edit(s) as well as additional shared edits. Adapted with permission from ref72. This procedure was approved by the HU/FAS Committee on the Use of Animals in Research & Teaching under Protocol No. 25–08.

Article Snippet: Plasmids pCS2-zT2TP (available from Koichi Kawakami lab 78 ) pTol2-hspDRv7_scGstlt (Addgene, plasmid ID 108870) pTol2-hsp70l:Cas9-t2A-GFP, 5×U6:sgRNA (Addgene, plasmid ID 108871) DNA oligonucleotide sequences (purified by standard desalting, can be ordered from IDT) Name Sequence Purpose Step qPCRctrl F 5′-TCAGTCAACCATTCAGTGGCCCAT-3′ PCR amplify ultraconserved genomic region 23 qPCRctrl R 5′-CAGGAAAGGGAATGCAGGGTTTGT-3′ PCR amplify ultraconserved genomic region 23 qPCRdsRed F 5′-GAGCGCGTGATGAACTTCGAGG-3′ PCR amplify dsRed transgenic region 23 qPCRdsRed R 5′-CAGCCCATAGTCTTCTTCTGCATTACG-3′ PCR amplify dsRed transgenic region 23 sgRNAl 5′TTCTAATACGACTCACTATAGACAGCAGTATCATCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA1 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA2 5′-TTCTAATACGACTCACTATAGAGAGCGCGCTCGTCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA2 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA3 5′-TTCTAATACGACTCACTATAGTCAGCA GTACTACTGACGAGTTTTAGAGCTAGA-3′ Synthesize sgRNA3 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA4 5′-TTCTAATACGACTCACTATAGACAGCAGTGTGTGAGTCTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA4 for CRISPR-Cas9 lineage barcoding by injection 27 scGESTALT F 5′-TCGAGCTCAAGCTTCGG-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 scGESTALT R 5′-CTGCCATTTGTCTCGAGGTC-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 inDrops_GP6 5′-GAGGACTACACCATCGTGGAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_PE1Sa 5′-CTCTTTCCCTACACGACGCTGGGTGTCGGGTGCAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_GP12 5′-TCGTCGGCAGCGTCAGATGTGTATAA GAGACAG NNNNNNNNNTCGAGCTCAA GCTTCGGAC-3′, where N stands for a random base PCR amplify short scGESTALT fragment from inDrops library 93 inDrops_PE1Sb 5′-CTCTTTCCCTACACGACGCT-3′ PCR amplify short scGESTALT fragment from inDrops library 93 R1-PCRix 5′-AATGATACGGCGACCACCGAGATCTACACxrefTCGTCGGCAGCGTC-3′, where xref is an index sequence for multiplexing (see Supplementary Table 2 ) PCR amplify transcriptome or scGESTALT final sequencing library 97 R2-PCR 5′-CAAGCAGAAGACGGCATACGAGATGGGTGTCGGGTGCAG-3′ PCR amplify transcriptome or scGESTALT final sequencing library 97 Open in a separate window

Techniques: Generated, Injection, Expressing, Sequencing

Journal: Nature protocols

Article Title: Large-scale reconstruction of cell lineages using single-cell readout of transcriptomes and CRISPRCas9 barcodes by scGESTALT

doi: 10.1038/s41596-018-0058-x

Figure Lengend Snippet: Zebrafish with single-copy heat shock promoter-driven scGESTALT barcode (to promote ubiquitous barcode expression at stage of interest) are crossed to zebrafish that express heat shock-inducible Cas9 and U6-driven sgRNAs 5–9. The barcode is cloned downstream of the dsRed coding sequence and upstream of the SV40 polyadenylation sequence (pA). Resulting embryos are injected with Cas9 protein and sgRNAs 1–4 at the one-cell stage (blue bars; early editing). The embryos are screened for GFP positive heart transgenics (cmlc2 promoter drives heart-specific GFP expression) at 30 hpf to identify embryos containing the barcode transgene, and sorted embryos are heat shocked to induce transgenic Cas9 for a second round of editing (orange bars; late editing). The embryos are screened again for ubiquitous GFP expression (Cas9 is linked to GFP with a t2A self-cleaving peptide), which indicates successful Cas9 transgene induction. Double transgenic embryos are grown for downstream profiling, and heat shocked at time of interest (e.g. juvenile stage 23–25 dpf) to induce expression of the edited barcode array prior to scRNA-seq analysis. Protocol steps for each stage are indicated. Adapted with permission from ref72.

Article Snippet: Plasmids pCS2-zT2TP (available from Koichi Kawakami lab 78 ) pTol2-hspDRv7_scGstlt (Addgene, plasmid ID 108870) pTol2-hsp70l:Cas9-t2A-GFP, 5×U6:sgRNA (Addgene, plasmid ID 108871) DNA oligonucleotide sequences (purified by standard desalting, can be ordered from IDT) Name Sequence Purpose Step qPCRctrl F 5′-TCAGTCAACCATTCAGTGGCCCAT-3′ PCR amplify ultraconserved genomic region 23 qPCRctrl R 5′-CAGGAAAGGGAATGCAGGGTTTGT-3′ PCR amplify ultraconserved genomic region 23 qPCRdsRed F 5′-GAGCGCGTGATGAACTTCGAGG-3′ PCR amplify dsRed transgenic region 23 qPCRdsRed R 5′-CAGCCCATAGTCTTCTTCTGCATTACG-3′ PCR amplify dsRed transgenic region 23 sgRNAl 5′TTCTAATACGACTCACTATAGACAGCAGTATCATCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA1 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA2 5′-TTCTAATACGACTCACTATAGAGAGCGCGCTCGTCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA2 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA3 5′-TTCTAATACGACTCACTATAGTCAGCA GTACTACTGACGAGTTTTAGAGCTAGA-3′ Synthesize sgRNA3 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA4 5′-TTCTAATACGACTCACTATAGACAGCAGTGTGTGAGTCTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA4 for CRISPR-Cas9 lineage barcoding by injection 27 scGESTALT F 5′-TCGAGCTCAAGCTTCGG-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 scGESTALT R 5′-CTGCCATTTGTCTCGAGGTC-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 inDrops_GP6 5′-GAGGACTACACCATCGTGGAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_PE1Sa 5′-CTCTTTCCCTACACGACGCTGGGTGTCGGGTGCAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_GP12 5′-TCGTCGGCAGCGTCAGATGTGTATAA GAGACAG NNNNNNNNNTCGAGCTCAA GCTTCGGAC-3′, where N stands for a random base PCR amplify short scGESTALT fragment from inDrops library 93 inDrops_PE1Sb 5′-CTCTTTCCCTACACGACGCT-3′ PCR amplify short scGESTALT fragment from inDrops library 93 R1-PCRix 5′-AATGATACGGCGACCACCGAGATCTACACxrefTCGTCGGCAGCGTC-3′, where xref is an index sequence for multiplexing (see Supplementary Table 2 ) PCR amplify transcriptome or scGESTALT final sequencing library 97 R2-PCR 5′-CAAGCAGAAGACGGCATACGAGATGGGTGTCGGGTGCAG-3′ PCR amplify transcriptome or scGESTALT final sequencing library 97 Open in a separate window

Techniques: Expressing, Clone Assay, Sequencing, Injection, Transgenic Assay

Journal: Nature protocols

Article Title: Large-scale reconstruction of cell lineages using single-cell readout of transcriptomes and CRISPRCas9 barcodes by scGESTALT

doi: 10.1038/s41596-018-0058-x

Figure Lengend Snippet: scGESTALT barcode zebrafish were crossed to zebrafish that express heat shock-inducible Cas9 and U6-driven sgRNAs 5–9. Resulting embryos were injected with Cas9 protein and sgRNAs 1–4 at the one-cell stage. Embryos were heat shocked at 30 hpf to induce transgenic Cas9 for a late round of editing. Double transgenic (scGESTALT+, hsp:Cas9+; lanes 2–8, n = 7 embryos) and single transgenic (scGESTALT+, hsp:Cas9−; lanes 9–12, n = 4 embryos) were identified by screening for GFP expression. The gel shows PCR results of amplifying the scGESTALT barcode (unedited = ~300 bp). Large smear patterns (120–250bp) are observed in early and late edited embryos (lanes 2–8), whereas embryos that were only mutated at sites 1–4 display less editing (lanes 9–12. The band at ~200 bp in lane 12 likely represents large deletion(s) between sites 1–4 that occurred early in development and was inherited by most cells. Note that samples with such dominant large deletions should not be used for downstream experiments and analyses as they are likely to have low barcode diversity). Sample in lane 11 was likely not efficiently injected. Lane 1 represents a control embryo, which was injected with Cas9 protein only (no sgRNAs 1–4, n = 1 embryo) and was not heat shocked. As expected, the barcode is not edited in this case. This procedure was approved by the HU/FAS Committee on the Use of Animals in Research & Teaching under Protocol No. 25–08.

Article Snippet: Plasmids pCS2-zT2TP (available from Koichi Kawakami lab 78 ) pTol2-hspDRv7_scGstlt (Addgene, plasmid ID 108870) pTol2-hsp70l:Cas9-t2A-GFP, 5×U6:sgRNA (Addgene, plasmid ID 108871) DNA oligonucleotide sequences (purified by standard desalting, can be ordered from IDT) Name Sequence Purpose Step qPCRctrl F 5′-TCAGTCAACCATTCAGTGGCCCAT-3′ PCR amplify ultraconserved genomic region 23 qPCRctrl R 5′-CAGGAAAGGGAATGCAGGGTTTGT-3′ PCR amplify ultraconserved genomic region 23 qPCRdsRed F 5′-GAGCGCGTGATGAACTTCGAGG-3′ PCR amplify dsRed transgenic region 23 qPCRdsRed R 5′-CAGCCCATAGTCTTCTTCTGCATTACG-3′ PCR amplify dsRed transgenic region 23 sgRNAl 5′TTCTAATACGACTCACTATAGACAGCAGTATCATCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA1 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA2 5′-TTCTAATACGACTCACTATAGAGAGCGCGCTCGTCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA2 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA3 5′-TTCTAATACGACTCACTATAGTCAGCA GTACTACTGACGAGTTTTAGAGCTAGA-3′ Synthesize sgRNA3 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA4 5′-TTCTAATACGACTCACTATAGACAGCAGTGTGTGAGTCTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA4 for CRISPR-Cas9 lineage barcoding by injection 27 scGESTALT F 5′-TCGAGCTCAAGCTTCGG-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 scGESTALT R 5′-CTGCCATTTGTCTCGAGGTC-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 inDrops_GP6 5′-GAGGACTACACCATCGTGGAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_PE1Sa 5′-CTCTTTCCCTACACGACGCTGGGTGTCGGGTGCAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_GP12 5′-TCGTCGGCAGCGTCAGATGTGTATAA GAGACAG NNNNNNNNNTCGAGCTCAA GCTTCGGAC-3′, where N stands for a random base PCR amplify short scGESTALT fragment from inDrops library 93 inDrops_PE1Sb 5′-CTCTTTCCCTACACGACGCT-3′ PCR amplify short scGESTALT fragment from inDrops library 93 R1-PCRix 5′-AATGATACGGCGACCACCGAGATCTACACxrefTCGTCGGCAGCGTC-3′, where xref is an index sequence for multiplexing (see Supplementary Table 2 ) PCR amplify transcriptome or scGESTALT final sequencing library 97 R2-PCR 5′-CAAGCAGAAGACGGCATACGAGATGGGTGTCGGGTGCAG-3′ PCR amplify transcriptome or scGESTALT final sequencing library 97 Open in a separate window

Techniques: Injection, Transgenic Assay, Expressing

Journal: Nature protocols

Article Title: Large-scale reconstruction of cell lineages using single-cell readout of transcriptomes and CRISPRCas9 barcodes by scGESTALT

doi: 10.1038/s41596-018-0058-x

Figure Lengend Snippet:

Article Snippet: Plasmids pCS2-zT2TP (available from Koichi Kawakami lab 78 ) pTol2-hspDRv7_scGstlt (Addgene, plasmid ID 108870) pTol2-hsp70l:Cas9-t2A-GFP, 5×U6:sgRNA (Addgene, plasmid ID 108871) DNA oligonucleotide sequences (purified by standard desalting, can be ordered from IDT) Name Sequence Purpose Step qPCRctrl F 5′-TCAGTCAACCATTCAGTGGCCCAT-3′ PCR amplify ultraconserved genomic region 23 qPCRctrl R 5′-CAGGAAAGGGAATGCAGGGTTTGT-3′ PCR amplify ultraconserved genomic region 23 qPCRdsRed F 5′-GAGCGCGTGATGAACTTCGAGG-3′ PCR amplify dsRed transgenic region 23 qPCRdsRed R 5′-CAGCCCATAGTCTTCTTCTGCATTACG-3′ PCR amplify dsRed transgenic region 23 sgRNAl 5′TTCTAATACGACTCACTATAGACAGCAGTATCATCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA1 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA2 5′-TTCTAATACGACTCACTATAGAGAGCGCGCTCGTCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA2 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA3 5′-TTCTAATACGACTCACTATAGTCAGCA GTACTACTGACGAGTTTTAGAGCTAGA-3′ Synthesize sgRNA3 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA4 5′-TTCTAATACGACTCACTATAGACAGCAGTGTGTGAGTCTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA4 for CRISPR-Cas9 lineage barcoding by injection 27 scGESTALT F 5′-TCGAGCTCAAGCTTCGG-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 scGESTALT R 5′-CTGCCATTTGTCTCGAGGTC-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 inDrops_GP6 5′-GAGGACTACACCATCGTGGAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_PE1Sa 5′-CTCTTTCCCTACACGACGCTGGGTGTCGGGTGCAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_GP12 5′-TCGTCGGCAGCGTCAGATGTGTATAA GAGACAG NNNNNNNNNTCGAGCTCAA GCTTCGGAC-3′, where N stands for a random base PCR amplify short scGESTALT fragment from inDrops library 93 inDrops_PE1Sb 5′-CTCTTTCCCTACACGACGCT-3′ PCR amplify short scGESTALT fragment from inDrops library 93 R1-PCRix 5′-AATGATACGGCGACCACCGAGATCTACACxrefTCGTCGGCAGCGTC-3′, where xref is an index sequence for multiplexing (see Supplementary Table 2 ) PCR amplify transcriptome or scGESTALT final sequencing library 97 R2-PCR 5′-CAAGCAGAAGACGGCATACGAGATGGGTGTCGGGTGCAG-3′ PCR amplify transcriptome or scGESTALT final sequencing library 97 Open in a separate window

Techniques: Sequencing, Transgenic Assay, CRISPR, Injection, Multiplexing

Journal: Nature protocols

Article Title: Large-scale reconstruction of cell lineages using single-cell readout of transcriptomes and CRISPRCas9 barcodes by scGESTALT

doi: 10.1038/s41596-018-0058-x

Figure Lengend Snippet:

Article Snippet: Plasmids pCS2-zT2TP (available from Koichi Kawakami lab 78 ) pTol2-hspDRv7_scGstlt (Addgene, plasmid ID 108870) pTol2-hsp70l:Cas9-t2A-GFP, 5×U6:sgRNA (Addgene, plasmid ID 108871) DNA oligonucleotide sequences (purified by standard desalting, can be ordered from IDT) Name Sequence Purpose Step qPCRctrl F 5′-TCAGTCAACCATTCAGTGGCCCAT-3′ PCR amplify ultraconserved genomic region 23 qPCRctrl R 5′-CAGGAAAGGGAATGCAGGGTTTGT-3′ PCR amplify ultraconserved genomic region 23 qPCRdsRed F 5′-GAGCGCGTGATGAACTTCGAGG-3′ PCR amplify dsRed transgenic region 23 qPCRdsRed R 5′-CAGCCCATAGTCTTCTTCTGCATTACG-3′ PCR amplify dsRed transgenic region 23 sgRNAl 5′TTCTAATACGACTCACTATAGACAGCAGTATCATCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA1 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA2 5′-TTCTAATACGACTCACTATAGAGAGCGCGCTCGTCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA2 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA3 5′-TTCTAATACGACTCACTATAGTCAGCA GTACTACTGACGAGTTTTAGAGCTAGA-3′ Synthesize sgRNA3 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA4 5′-TTCTAATACGACTCACTATAGACAGCAGTGTGTGAGTCTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA4 for CRISPR-Cas9 lineage barcoding by injection 27 scGESTALT F 5′-TCGAGCTCAAGCTTCGG-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 scGESTALT R 5′-CTGCCATTTGTCTCGAGGTC-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 inDrops_GP6 5′-GAGGACTACACCATCGTGGAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_PE1Sa 5′-CTCTTTCCCTACACGACGCTGGGTGTCGGGTGCAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_GP12 5′-TCGTCGGCAGCGTCAGATGTGTATAA GAGACAG NNNNNNNNNTCGAGCTCAA GCTTCGGAC-3′, where N stands for a random base PCR amplify short scGESTALT fragment from inDrops library 93 inDrops_PE1Sb 5′-CTCTTTCCCTACACGACGCT-3′ PCR amplify short scGESTALT fragment from inDrops library 93 R1-PCRix 5′-AATGATACGGCGACCACCGAGATCTACACxrefTCGTCGGCAGCGTC-3′, where xref is an index sequence for multiplexing (see Supplementary Table 2 ) PCR amplify transcriptome or scGESTALT final sequencing library 97 R2-PCR 5′-CAAGCAGAAGACGGCATACGAGATGGGTGTCGGGTGCAG-3′ PCR amplify transcriptome or scGESTALT final sequencing library 97 Open in a separate window

Techniques: Concentration Assay, Plasmid Preparation

Journal: Nature protocols

Article Title: Large-scale reconstruction of cell lineages using single-cell readout of transcriptomes and CRISPRCas9 barcodes by scGESTALT

doi: 10.1038/s41596-018-0058-x

Figure Lengend Snippet:

Article Snippet: Plasmids pCS2-zT2TP (available from Koichi Kawakami lab 78 ) pTol2-hspDRv7_scGstlt (Addgene, plasmid ID 108870) pTol2-hsp70l:Cas9-t2A-GFP, 5×U6:sgRNA (Addgene, plasmid ID 108871) DNA oligonucleotide sequences (purified by standard desalting, can be ordered from IDT) Name Sequence Purpose Step qPCRctrl F 5′-TCAGTCAACCATTCAGTGGCCCAT-3′ PCR amplify ultraconserved genomic region 23 qPCRctrl R 5′-CAGGAAAGGGAATGCAGGGTTTGT-3′ PCR amplify ultraconserved genomic region 23 qPCRdsRed F 5′-GAGCGCGTGATGAACTTCGAGG-3′ PCR amplify dsRed transgenic region 23 qPCRdsRed R 5′-CAGCCCATAGTCTTCTTCTGCATTACG-3′ PCR amplify dsRed transgenic region 23 sgRNAl 5′TTCTAATACGACTCACTATAGACAGCAGTATCATCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA1 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA2 5′-TTCTAATACGACTCACTATAGAGAGCGCGCTCGTCGACTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA2 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA3 5′-TTCTAATACGACTCACTATAGTCAGCA GTACTACTGACGAGTTTTAGAGCTAGA-3′ Synthesize sgRNA3 for CRISPR-Cas9 lineage barcoding by injection 27 sgRNA4 5′-TTCTAATACGACTCACTATAGACAGCAGTGTGTGAGTCTAGTTTTAGAGCTAGA-3′ Synthesize sgRNA4 for CRISPR-Cas9 lineage barcoding by injection 27 scGESTALT F 5′-TCGAGCTCAAGCTTCGG-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 scGESTALT R 5′-CTGCCATTTGTCTCGAGGTC-3′ PCR amplify scGESTALT fragment for assessing editing efficiency 43 inDrops_GP6 5′-GAGGACTACACCATCGTGGAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_PE1Sa 5′-CTCTTTCCCTACACGACGCTGGGTGTCGGGTGCAG-3′ PCR amplify long scGESTALT fragment from inDrops library 90 inDrops_GP12 5′-TCGTCGGCAGCGTCAGATGTGTATAA GAGACAG NNNNNNNNNTCGAGCTCAA GCTTCGGAC-3′, where N stands for a random base PCR amplify short scGESTALT fragment from inDrops library 93 inDrops_PE1Sb 5′-CTCTTTCCCTACACGACGCT-3′ PCR amplify short scGESTALT fragment from inDrops library 93 R1-PCRix 5′-AATGATACGGCGACCACCGAGATCTACACxrefTCGTCGGCAGCGTC-3′, where xref is an index sequence for multiplexing (see Supplementary Table 2 ) PCR amplify transcriptome or scGESTALT final sequencing library 97 R2-PCR 5′-CAAGCAGAAGACGGCATACGAGATGGGTGTCGGGTGCAG-3′ PCR amplify transcriptome or scGESTALT final sequencing library 97 Open in a separate window

Techniques: Concentration Assay